Why Did Rwanda Join The Commonwealth, Best Primary Care Physician In Broward County, Articles M

Be sure to include the number of the fragment you selected. (Hint: It has DNA) What step of protein synthesis did you model there? Digital Science Pixel Art Mystery Pictures (automatic coloring) with GOOGLE FORMS. 3.3: Protein Synthesis Pizza - Social Sci LibreTexts . UUG = forUUU = life *Key to DNA Fragments (write these sequences on cards): ATGAAAAACAAGGTACACATCTAG ATGAAAAACAATTGCACGTAG ATGTAAACCACTACATAG ATGAGAAGTAGGAGAAGCATAATCTAG ATGATTCAACACATCCAGCCACATTAG ATGCCCCCGAGAAGCCCTTAG ATGCGACGCCGGCGTTAG ATGCTACTCATAGATCTGCTTTAG ATGTAAAGGGAAGACGAGTAG ATGCCCCCGGCAGCCGCGTAG ATGGCTCCGAGAGGAGGCAGAGGGTAG ATGAAAGGTAAGGTAGTCTAG ATGAAAGTGAAGGTTTAG ATGTAAAGGGAATACTATTCATAG ATGTAATCCTCGTCTCGGCGTTAG ATGATAGATCTGCTTCCGAGAAGCTAG ATGCCCCCGGAATGATGCTAG ATGTGGGTATGTCGGCGTTAG ATGTTACCGAGATTCTTGTTTTAG ATGTTATCCTCGTGGTTGTTTTAG Key for the sentences *20 Sentences: Your mother wears a rubber band. 2. Students be also answer review questions about transcription and translation. It addresses the following NGSS standard: . Breaking the Code: Protein Synthesis Lab, Procedure Code Sheet, DNA to RNA Code Key, Rice Krispie Treats Recipe Procedure (Procedure Code Sheet translated), Lab materials for recipe: 3 tablespoons of margarine, 1 package of regular marshmallows, 6 cups of rice krispies, cooking spray, pans, knife, large bowl, microwave. But the analogy had to be relatable. Each pair of students get a set of steps printed on strips of laminated stock paper. Genes are the lengths of DNA molecules that determine the structure of polypeptides (the building blocks of proteins) that our cells make. Note: Students may work alone or in groups (it is better to assign one student to be the mRNA, another student to write down the anticodons (ribosome) and the third student to search out the proper words (tRNA). Give the base sequence of the strand of mRNA read from the original DNA strand. endobj 3) Using Figure 2, find the trait that matches the amino acid sequence. is analogous to a protein. The students should then demonstrate their understanding of protein synthesis using the knowledge they have gained through the lab activity in their lab report write-up. Drink water every day. Review And Practice Protein Synthesis Answer Key Author: communityvoices.sites.post-gazette.com-2023-04-29T00:00:00+00:01 Subject: Review And Practice Protein Synthesis Answer Key Keywords: review, and, practice, protein, synthesis, answer, key Created Date: 4/29/2023 3:27:44 AM PDF The Monster Mash - Science4Inquiry